Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU018761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Furin

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGAGCCAAGAGGGACGTGTATCAGGAGCCCACGGACCCCAAGTTCCCCCAGCAGTGGTACCTGTCTGGTGTCACTCAGCGAGACCTGAATGTGAAGGAGGCCTGGGCCCAGGGCTTCACAGGCCATGGCATTGTGGTCTCCATCCTGGATGACGGCATTGAGAAGAATCATCCCGACCTAGCAGGCAATTATGACCCTGGAGCCAGTTTTGACGTGAATGACCAGGACCCCGACCCACAGCCTCGGTACACACAGATGAATGACAACAGGCATGGCACTCGCTGTGCCGGGGAAGTGGCAGCAGTGGCCAACAATGGTGTCTGTGGCGTAGGTGTAGCTTACAATGCCCGAATTGGAGGGGTGCGGATGTTGGATGGCGAGGTGACTGATGCAGTAGAGGCACGTTCGCTGGGCCTGAATCCCAACCACATCCACAT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Z Zhou et al.
Cell death & disease, 4, e593-e593 (2013-04-20)
The multinucleated syncytial trophoblast, which forms the outermost layer of the placenta and serves multiple functions, is differentiated from and maintained by cytotrophoblast cell fusion. Deficiencies in syncytial trophoblast differentiation or maintenance likely contribute to intrauterine growth restriction and pre-eclampsia
Xiaokui Yang et al.
PloS one, 8(2), e50479-e50479 (2013-02-19)
Folliculogenesis is tightly controlled by a series of hormones, growth factors and cytokines, many of which are secreted as proproteins and require processing by proteases before becoming functional. Furin is a member of the subtilisin-like proteases that activate large numbers
Diana Farhat et al.
British journal of cancer, 122(6), 885-894 (2020-01-29)
Breast cancer is the second most common cancer in the world. Despite advances in therapies, the mechanisms of resistance remain the underlying cause of morbidity and mortality. Lipoic acid (LA) is an antioxidant and essential cofactor in oxidative metabolism. Its
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica