Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU012321

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Angpt2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAACCAGACAGCAGCACAAACTCGGAAACTGACTGATGTGGAAGCCCAAGTACTAAACCAGACGACAAGACTCGAGCTGCAGCTTCTCCAACATTCTATTTCTACCAACAAATTGGAAAAGCAGATTTTGGATCAGACCAGTGAAATAAACAAGCTACAAAATAAGAACAGCTTCCTAGAACAGAAAGTTCTGGACATGGAGGGCAAGCACAGCGAGCAGCTACAGTCCATGAAGGAGCAGAAGGACGAGCTCCAGGTGCTGGTGTCCAAGCAGAGCTCTGTCATTGACGAGCTGGAGAAGAAGCTGGTGACAGCCACGGTCAACAACTCGCTCCTTCAGAAGCAGCAGCATGACCTAATGGAGACCGTCAACAGCTTGCTGACCATGATGTCATCACCCAACTCCAAGAGCTCGGTTGCTAT

Ensembl | Número de adesão de camundongo

ENSMUSG00000031465

nº de adesão NCBI

NM_007426

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... ANGPT2(11601) , Angpt2(11601)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Don Yuen et al.
Investigative ophthalmology & visual science, 55(5), 3320-3327 (2014-05-02)
Lymphatic research has progressed rapidly in recent years. Lymphatic dysfunction has been found in myriad disorders from cancer metastasis to transplant rejection; however, effective treatment for lymphatic disorders is still limited. This study investigates the role of angiopoietin-2 (Ang-2) in
Changqing Luo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 34(3), 916-928 (2014-09-10)
To investigate the role of angiopoietin-2 (Ang-2) and IL-18 in the pathogenesis of diabetic nephropathy (DN) and the molecular mechanisms through which alprostadil protects renal function. DN was induced by streptozotocin and intraperitoneal injection of alprostadil was given to diabetic

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica