Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU008541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Robld3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTGCAGGTCAGGGTTAAGAGACGCAGGCATGCTGCGTCCCAAGGCTTTGACGCAGGTGCTAAGCCAAGCCAACACTGGAGGAGTCCAGAGCACCCTGCTGCTGAATAATGAGGGATCGCTGCTGGCCTACTCCGGTTATGGGGACACAGATGCCCGGGTCACTGCGGCCATCGCCAGTAACATCTGGGCCGCGTATGATAGGAACGGGAACCAAGCGTTTAATGAAGACAGTCTCAAATTTATCCTGATGGACTGCATGGAGGGCCGTGTAGCCATTACGAGGGTGGCCAACCTTCTGCTATGTATGTATGCCAAGGAGACCGTAGGCTTCGGAATGCTCAAGGCTAAGGCCCAGGCCCTGGTGCAGTACCTGGAGGAACCCCTCACCCAAGTAGCAGCATCATAACAGCGTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000028062

nº de adesão NCBI

NM_031248

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... ROBLD3(83409) , Robld3(83409)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ukhyun Jo et al.
Oncotarget, 5(5), 1265-1278 (2014-03-25)
Oncogenic alterations of epidermal growth factor receptor (EGFR) signaling are frequently observed in lung cancer patients with worse differentiation and poor prognosis. However, the therapeutic efficacy of EGFR-tyrosine kinase inhibitors (TKIs) is currently limited in selected patients with EGFR mutations.
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica