Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU003111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ihh

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTCTAACCACTGCCCTCCTGGAACTGCTGTGCTGGATCCAAAGGCCTCCTCACCAGGAAGGCTCTGGCCCTGGAAGGCACCTGGCCTGAGGTTGTCTCCGTCCTCTGTGCCAGAGTGGAGACACCATTGAGACTTGACCAGGTTTGCTGGGCCCCGAACCTTCATCTTGGTGTAGAGCTGTGAACTGAGCTGACAAGCGTGTGGTAGGCTCTCTTTTCCTAGAGACCGTAAGACCCAGCTAGCTCTGGCTGCGATTCTTCACACGCATTCCATCTGTCTTTGGACTGCTTACTCCAATGTTTCTCGGGGCCTGGGATTGTGACTTTACTGTTGGCAACTGATCACAGTATGAAGAGAGGCTGCCCGTAGATGGGCTTGCACCTCAGTCGATGCTGCTAGATTCCC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ang Deng et al.
Experimental and therapeutic medicine, 15(1), 789-794 (2018-02-13)
The proliferative rate of chondrocytes affects bone elongation. Chondrocyte hypertrophy is required for endochondral bone formation as chondrocytes secrete factors required for osteoblast differentiation and maturation. Previous studies have demonstrated that the Indian hedgehog (Ihh) signaling pathway is a key
Shaowei Wang et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 24(8), 1720-1728 (2015-05-11)
To determine the role of Indian hedgehog (Ihh) signaling in human cartilage endplate (CEP) degeneration. CEP-degenerated tissues from patients with Modic I or II changes (n = 9 and 45, respectively) and normal tissues from vertebral burst fracture patients (n

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica