Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU001851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nkx3-1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGGCATCCATCTTTCTGGTAGCAACAGTTCTGCTGATAACTGCATATATCAGAAACTGTCTTCCCTGGGGGTCTCTGGGAAAAAGCCACAGTGGCTGATGTCAAGGAGTCGGAAGCAAGAAATGTACAGATGCAAACTGTTGGGGGTTCCCAGGGAACACTCCAATTCTTCTCTGGTGGGCAGGTGAAAGATCTGGGGCAGTGACTATTTGAAGATGTAGTCCCAGTTCCAAGTGTCCTGTAGGTGACTGCTGCCCGCTCCCCTGTTTAGAGAGAGCCAGGCAAGTTTGAGTCTTGTTTCCAGAACTTAGAATGGCTACAGATGCAATGGCTATATCGTTCCTAGGAATTCTGTTGTGGCAACTCCATCCTCTCCCATGACTGAGTATCATGGAAGGGCCAA

Ensembl | Número de adesão de camundongo

ENSMUSG00000022061

nº de adesão NCBI

NM_010921

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... NKX3-1(18095) , Nkx3-1(18095)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XWR
AOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xi-Liang Wang et al.
PloS one, 10(8), e0136049-e0136049 (2015-08-28)
MicroRNA (miRNA) is a kind of short non-coding RNA, involved in various cellular processes. During keratinocyte differentiation, miRNAs act as important regulators. In this study, we demonstrated by microarray assay that the expression of miR-378b significantly increased during keratinocytes differentiation.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica