Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU001851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nkx3-1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGGCATCCATCTTTCTGGTAGCAACAGTTCTGCTGATAACTGCATATATCAGAAACTGTCTTCCCTGGGGGTCTCTGGGAAAAAGCCACAGTGGCTGATGTCAAGGAGTCGGAAGCAAGAAATGTACAGATGCAAACTGTTGGGGGTTCCCAGGGAACACTCCAATTCTTCTCTGGTGGGCAGGTGAAAGATCTGGGGCAGTGACTATTTGAAGATGTAGTCCCAGTTCCAAGTGTCCTGTAGGTGACTGCTGCCCGCTCCCCTGTTTAGAGAGAGCCAGGCAAGTTTGAGTCTTGTTTCCAGAACTTAGAATGGCTACAGATGCAATGGCTATATCGTTCCTAGGAATTCTGTTGTGGCAACTCCATCCTCTCCCATGACTGAGTATCATGGAAGGGCCAA

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xi-Liang Wang et al.
PloS one, 10(8), e0136049-e0136049 (2015-08-28)
MicroRNA (miRNA) is a kind of short non-coding RNA, involved in various cellular processes. During keratinocyte differentiation, miRNAs act as important regulators. In this study, we demonstrated by microarray assay that the expression of miR-378b significantly increased during keratinocytes differentiation.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica