Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU232231

Sigma-Aldrich

MISSION® esiRNA

targeting human IRGM

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGAAGCCATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCTTCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACCCTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCTGCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAGTTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTGCAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAA

Ensembl | Número de adesão de ser humano

ENSG00000237693

nº de adesão NCBI

NM_001145805

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IRGM(345611) , IRGM(345611)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yu-Cheng Lin et al.
Journal of hepatology, 65(6), 1209-1216 (2016-07-16)
Autophagy has been shown to be crucial in the regulation of the intracellular lipid stores in hepatocytes. We hypothesize that immunity-related GTPase family M (IRGM) gene (an autophagy-related gene) variants confer the susceptibility to non-alcoholic fatty liver disease (NAFLD) development.
Chih-Peng Chang et al.
PloS one, 6(12), e28323-e28323 (2011-12-14)
Interferon-gamma (IFN-γ), a potent Th1 cytokine with multiple biological functions, can induce autophagy to enhance the clearance of the invading microorganism or cause cell death. We have reported that Concanavalin A (Con A) can cause autophagic cell death in hepatocytes
Xize Guo et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14768-14779 (2020-09-18)
Mitochondria is a double membrane-bound cellular organelle that generates energy to maintain the homeostasis of cells. Immunity-related GTPase M (IRGM) in human locates at the inner membrane of mitochondria and is best known for its role in regulating autophagy against
Kautilya Kumar Jena et al.
EMBO reports, 21(9), e50051-e50051 (2020-07-28)
Activation of the type 1 interferon response is extensively connected to the pathogenesis of autoimmune diseases. Loss of function of Immunity Related GTPase M (IRGM) has also been associated to several autoimmune diseases, but its mechanism of action is unknown.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica