Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU227251

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPD

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGAGAGACTCAGCAACGACCCATACCTCAGACCCGACGGCCCGGAGCGGAGCGCGCCCTGCCCTGGCGCAGCCAGAGCCGCCGGGTGCCCGCTGCAGTTTCTTGGGACATAGGAGCGCAAAGAAGCTACAGCCTGGACTTACCACCACTAAACTGCGAGAGAAGCTAAACGTGTTTATTTTCCCTTAAATTATTTTTGTAATGGTAGCTTTTTCTACATCTTACTCCTGTTGATGCAGCTAAGGTACATTTGTAAAAAGAAAAAAAACCAGACTTTTCAGACAAACCCTTTGTATTGTAGATAAGAGGAAAAGACTGAGCATGCTCACTTTTTTATATTAATTTTTACAGTATTTGTAAGAATAAAGCAGCATTTGAAATCGCCC

Ensembl | Número de adesão de ser humano

ENSG00000221869

nº de adesão NCBI

NM_005195

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CEBPD(1052) , CEBPD(1052)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

David A Knowles et al.
PLoS computational biology, 15(5), e1006743-e1006743 (2019-05-29)
Drug screening studies typically involve assaying the sensitivity of a range of cancer cell lines across an array of anti-cancer therapeutics. Alongside these sensitivity measurements high dimensional molecular characterizations of the cell lines are typically available, including gene expression, copy
Kenjiro Tanaka et al.
British journal of pharmacology, 173(6), 1058-1069 (2016-01-12)
The sympathetic nervous system regulates bone remodelling, in part, through ß2 -adrenoceptor signalling. However, the physiological role of α1 -adrenoceptor signalling in bone in vivo remains unclear. Therefore, to obtain a deeper understanding of bone remodelling by the sympathetic nervous
Leonie Hartl et al.
Cancers, 12(9) (2020-09-11)
CCAAT/enhancer-binding protein δ (C/EBPδ) is a transcription factor involved in growth arrest and differentiation, which has consequently been suggested to harbor tumor suppressive activities. However, C/EBPδ over-expression correlates with poor prognosis in glioblastoma and promotes genomic instability in cervical cancer

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica