Todas as fotos(1)

Key Documents

COO/COA

EHU221111

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human AF165138.7

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AATTTAGAGAATGCAAAACCAAAAAAGAGAAAGTTATTCCGGAGATTTATGTCTGAAAATAAAATATTTGAAGGAAAAACTGTGAATGACAAAATCTGGCAGGAACACAGCAAGCATAAGAATGATTCCCACATCAGAAGGCCCTGTCAGCTAAAAGATCTAAATGAAAATGATTTTCTAAGTAACAACATACATACCTATCAAGGAAAAACTCTACAAGGAACTTCCTATCAGGTGACCTCTGAATGTTGGAGTCCATTTCACTATCAAAGACATGTTGAGACCACTG

Ensembl | Número de adesão de ser humano

ENSG00000243440

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AF165138.7(388813) , AF165138.7()

Categorias relacionadas

MISSION® esiRNA

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Human microRNA-24 modulates highly pathogenic avian-origin H5N1 influenza A virus infection in A549 cells by targeting secretory pathway furin.

Emma-Kate Loveday et al.

The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)

A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A

Dihydrotanshinone I induced apoptosis and autophagy through caspase dependent pathway in colon cancer.

Lin Wang et al.

Phytomedicine : international journal of phytotherapy and phytopharmacology, 22(12), 1079-1087 (2015-11-10)

Dihydrotanshinone I (DHTS) was previously reported to exhibit the most potent anti-cancer activity among several tanshinones in colon cancer cells. Its cytotoxic action was reactive oxygen species (ROS) dependent but p53 independent. To further study the anti-cancer activity of DHTS

Placental vitamin D receptor expression is decreased in human idiopathic fetal growth restriction.

T P H Nguyen et al.

Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)

Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica