Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU218531

Sigma-Aldrich

MISSION® esiRNA

targeting human GPX1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTGGTGGGTTCGAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGTGAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCCACCGCGCTTATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTTTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGCTGTGCCTAGGGCGCCCCTCCTACCCCGGCTGCTTGGCAGTTGCAGTGCTGCTGTCTCGGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAGATGGGTGCTGGTCCTGTTGATCCCAGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhiquan Huang et al.
International journal of oncology, 48(3), 1271-1279 (2016-01-20)
1,25-Dihydroxyvitamin D3 (1,25D3) is the active form of vitamin D with antineoplastic effects. The glutathione peroxidase-1 (GPX1) gene is associated with tumour progression. The present study aimed to explore the role of GPX1 in 1,25D3-mediated progression of salivary adenoid cystic
Yukari Nakano et al.
Metallomics : integrated biometal science, 12(11), 1693-1701 (2020-09-15)
Excessive zinc ion (Zn2+) release is induced in pathological situations and causes neuronal cell death. Previously, we have reported that copper ions (Cu2+) markedly exacerbated Zn2+-induced neuronal cell death by potentiating oxidative stress, the endoplasmic reticulum (ER) stress response, and
Yongmin Yan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 25(2), 465-479 (2017-01-17)
Exosomes are small biological membrane vesicles secreted by various cells, including mesenchymal stem cells (MSCs). We previously reported that MSC-derived exosomes (MSC-Ex) can elicit hepatoprotective effects against toxicant-induced injury. However, the success of MSC-Ex-based therapy for treatment of liver diseases
Xiangfeng Gan et al.
International journal of clinical and experimental medicine, 7(9), 2530-2540 (2014-10-31)
Esophageal cancer is one of the most common cancers worldwide. Despite recent progress in the development of novel therapies, esophageal carcinoma remains an aggressive cancer associated with a poor prognosis. The glutathione peroxidase 1 (GPX1) gene located on chromosome 3p21.3
Sui Peng et al.
American journal of physiology. Gastrointestinal and liver physiology, 307(2), G129-G139 (2014-05-24)
Hydrophobic bile acids like deoxycholic acid (DCA), which cause oxidative DNA damage and activate NF-κB in Barrett's metaplasia, might contribute to carcinogenesis in Barrett's esophagus. We have explored mechanisms whereby ursodeoxycholic acid (UDCA, a hydrophilic bile acid) protects against DCA-induced

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica