Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU158481

Sigma-Aldrich

MISSION® esiRNA

targeting human CHEK2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAAT

Ensembl | Número de adesão de ser humano

ENSG00000183765

nº de adesão NCBI

NM_001005735

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CHEK2(11200) , CHEK2(11200)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
DAV
ACIU
MTU
XMU
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Thomas Ströbel et al.
Scientific reports, 7(1), 9674-9674 (2017-08-31)
Ape1 is the major apurinic/apyrimidinic (AP) endonuclease activity in mammalian cells, and a key factor in base-excision repair of DNA. High expression or aberrant subcellular distribution of Ape1 has been detected in many cancer types, correlated with drug response, tumor
Wei Liu et al.
Oncotarget, 9(1), 346-360 (2018-02-09)
Despite advances in deciphering the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), patients with relapsed/refractory disease, particularly those with adverse genetic features (e.g., mutated p53 or double hit lymphoma (DHL)) have very poor prognoses, and effective therapies are lacking.
T-Y Chen et al.
Oncogenesis, 4, e180-e180 (2015-12-23)
The antitumor drug etoposide (ETO) is widely used in treating several cancers, including adrenocortical tumor (ACT). However, when used at sublethal doses, tumor cells still survive and are more susceptible to the recurring tumor due to centrosome amplification. Here, we
Svasti Haricharan et al.
Cancer discovery, 7(10), 1168-1183 (2017-08-13)
Significant endocrine therapy-resistant tumor proliferation is present in ≥20% of estrogen receptor-positive (ER+) primary breast cancers and is associated with disease recurrence and death. Here, we uncover a link between intrinsic endocrine therapy resistance and dysregulation of the MutL mismatch
Yuping Chen et al.
Science advances, 6(1), eaax5819-eaax5819 (2020-01-09)
Autophagy is an evolutionarily conserved catabolic process, which plays a vital role in removing misfolded proteins and clearing damaged organelles to maintain internal environment homeostasis. Here, we uncovered the checkpoint kinase 2 (CHK2)-FOXK (FOXK1 and FOXK2) axis playing an important
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica