Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU158451

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT3B

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCGACAGCTCTCCAATACTCAGGTTAATGCTGAAAAATCATCCAAGACAGTTATTGCAAGAGTTTAATTTTTGAAAACTGGCTACTGCTCTGTGTTTACAGACGTGTGCAGTTGTAGGCATGTAGCTACAGGACATTTTTAAGGGCCCAGGATCGTTTTTTCCCAGGGCAAGCAGAAGAGAAAATGTTGTATATGTCTTTTACCCGGCACATTCCCCTTGCCTAAATACAAGGGCTGGAGTCTGCACGGGACCTATTAGAGTATTTTCCACAATGATGATGATTTCAGCAGGGATGACGTCATCATCACATTCAGGGCTATTTTTTCCCCCACAAACCCAAGGGCAGGGGCCACTCTTAGCTAAATCCCTCCCCGTGACTGCAATAGAACCCTCTGGGGAGC

Ensembl | Número de adesão de ser humano

ENSG00000088305

nº de adesão NCBI

NM_175849

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DNMT3B(1789) , DNMT3B(1789)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chelsea R McCoy et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(16), 3144-3158 (2019-01-27)
There is growing evidence of abnormal epigenetic processes playing a role in the neurobiology of psychiatric disorders, although the precise nature of these anomalies remains largely unknown. To study neurobiological (including epigenetic) factors that influence emotionality, we use rats bred
Hiroaki Fujimori et al.
Scientific reports, 5, 18231-18231 (2015-12-17)
A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ-irradiation and
Yue Zhou et al.
American journal of translational research, 11(3), 1736-1747 (2019-04-12)
Temporomandibular joint (TMJ) arthritis causes severe debilitation and has few treatment options. Here, we found a small molecule, DNA methyltransferase 3B (Dnmt3b), as a putative therapeutic target, partially rescued osteoarthritic phenotype. Dnmt3b was detected differentially expressed in cell zones of
Bo Wang et al.
BMC cancer, 18(1), 817-817 (2018-08-15)
Breast cancer is the most common malignancy in women worldwide. Although the endocrine therapy that targets estrogen receptor α (ERα) signaling has been well established as an effective adjuvant treatment for patients with ERα-positive breast cancers, long-term exposure may eventually
Yue Teng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2341-2352 (2016-11-11)
Epigenetic abnormalities are increasingly observed in multiple malignancies, including epithelial ovarian cancer (EOC), and their effects can be significantly counteracted by tumor-suppressor microRNAs, namely epi-miRNAs. Here, we investigated the role of miR-29b, a well-established epi-miRNA, in the DNA methylation regulation
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica