Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU157051

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM10

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTCAAGCTGCTGGAGACCTGCGTCAGTGAGCAGCATGAATACCACTGGCATGATGGTGTGAAGAGGTTTTTCAAATGTCCCTGTGGAAACAGAAGCATCTCCTTGGACAGACTCCCGAACAAGCACTGCAGTAACTGTGGCCTCTACAAATGGGAACGGGACGGAATGCTAAAGGAAAAGACTGGTCCAAAGATAGGAGGAGAAACTCTGTTACCAAGAGGAGAAGAACATGCTAAATTTCTGAACAGCCTTAAATAACCCGAACTTCAGACATTTTCCCACAGACTTCCTGGCCTCCTGTGACTCTGGAAAGCAAAGGATTGGCTGTGTATTGTCCATTGATTCCTGATTGACGCCGTCAAAAACAAATGCTTGTTAAGCCCATAAGCTTTGCCTGCTTACTTTCTGCCATTGGG

Ensembl | Número de adesão de ser humano

ENSG00000065328

nº de adesão NCBI

NM_182751

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MCM10(55388) , MCM10(55388)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Feilun Cui et al.
The Prostate, 78(16), 1299-1310 (2018-08-11)
Prostate cancer (PCa) is one of the most malignant tumors of the male urogenital system. There is an urgent need to identify novel biomarkers for PCa. In this study, we evaluated the expression levels of MCM10 in prostate cancer by
Peng Kang et al.
Journal of molecular neuroscience : MN, 70(5), 759-768 (2020-02-08)
Minichromosome maintenance 10 (MCM10) plays an important role in DNA replication and is expressed in a variety of tumors, including glioma. However, its role and mechanism in glioma remain elusive. The purpose of this study was to examine the molecular
Wei-Dong Yang et al.
Journal of biochemical and molecular toxicology, 33(7), e22330-e22330 (2019-04-17)
The minichromosome maintenance protein 10 (MCM10) is one of the MCM proteins that initiate DNA replication by interacting with CDC45-MCM2-7. It has been reported that MCM10 has a role in breast cancer progression. However, MCM10 in breast cancer is still not comprehensively
Bizhan Romani et al.
The Journal of biological chemistry, 290(28), 17380-17389 (2015-06-03)
Human immunodeficiency virus type 1 Vpr is an accessory protein that induces G2/M cell cycle arrest. It is well documented that interaction of Vpr with the Cul4-DDB1[VprBP] E3 ubiquitin ligase is essential for the induction of G2/M arrest. In this

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica