Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU156801

Sigma-Aldrich

MISSION® esiRNA

targeting human CSK

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTACCGAGGGAACAAAGTCGCCGTCAAGTGCATTAAGAACGACGCCACTGCCCAGGCCTTCCTGGCTGAAGCCTCAGTCATGACGCAACTGCGGCATAGCAACCTGGTGCAGCTCCTGGGCGTGATCGTGGAGGAGAAGGGCGGGCTCTACATCGTCACTGAGTACATGGCCAAGGGGAGCCTTGTGGACTACCTGCGGTCTAGGGGTCGGTCAGTGCTGGGCGGAGACTGTCTCCTCAAGTTCTCGCTAGATGTCTGCGAGGCCATGGAATACCTGGAGGGCAACAATTTCGTGCATCGAGACCTGGCTGCCCGCAATGTGCTGGTGTCTGAGGACAACGTGGCCAAGGTCAGCGACTTTGGTCTCACCAAGGAGGCGTCCAGCACCCAGGACACGGGCAAGCTGCCAGTCAAGTGGACAGCCCCTGAGGCCCTGAGAGAGAAGAAATTCTCCACTAAGTCTGACGTGTGGAGTTTCGGAAT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Gaofeng Fan et al.
The Journal of biological chemistry, 290(26), 15934-15947 (2015-04-22)
Despite significant evidence to the contrary, the view that phosphatases are "nonspecific" still pervades the field. Systems biology approaches to defining how signal transduction pathways are integrated at the level of whole organisms also often downplay the contribution of phosphatases
Dana C Danielson et al.
Biochemical and biophysical research communications, 463(4), 1135-1140 (2015-06-17)
RNA silencing is a gene regulatory and host defense mechanism whereby small RNA molecules are engaged by Argonaute (AGO) proteins, which facilitate gene knockdown of complementary mRNA targets. Small molecule inhibitors of AGO represent a convenient method for reversing this

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica