Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU156191

Sigma-Aldrich

MISSION® esiRNA

targeting human TM4SF1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAAAAGAACCAACCCAGGACAGAGCCACAATCTTCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Young Ran Park et al.
International journal of oncology, 48(5), 2135-2143 (2016-03-18)
Transmembrane-4-L6 family 1 (TM4SF1) is upregulated in colorectal carcinoma (CRC). However, the mechanism leading to inhibition of the TM4SF1 is not known. In the present study, we investigated the regulation of TM4SF1 and function of microRNAs (miRNAs) in CRC invasion
Yu-Cheng Su et al.
mAbs, 6(4), 1069-1083 (2014-05-31)
Modification of antibody class and binding properties typically requires cloning of antibody genes, antibody library construction, phage or yeast display and recombinant antibody expression. Here, we describe an alternative "cloning-free" approach to generate antibodies with altered antigen-binding and heavy chain
Yonghoon Kwon et al.
PloS one, 9(9), e108771-e108771 (2014-09-25)
5' AMP-activated protein kinase (AMPK) is a highly conserved serine-threonine kinase that regulates energy expenditure by activating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. Therefore AMPK activators are considered to be drug targets for treatment of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica