Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU156131

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP4

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chanya Srisaowakarn et al.
Infection and immunity, 88(3) (2019-12-11)
Melioidosis is an infectious disease with a high mortality rate responsible for community-acquired sepsis in Southeast Asia and Northern Australia. The causative agent of this disease is Burkholderia pseudomallei, a Gram-negative bacterium that resides in soil and contaminated natural water.
Kwong Tai Cheng et al.
The Journal of clinical investigation, 127(11), 4124-4135 (2017-10-11)
Acute lung injury is a leading cause of death in bacterial sepsis due to the wholesale destruction of the lung endothelial barrier, which results in protein-rich lung edema, influx of proinflammatory leukocytes, and intractable hypoxemia. Pyroptosis is a form of
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 311(5), E825-E835 (2016-11-03)
Obesity is associated with metabolic tissue infiltration by monocyte-derived macrophages. Saturated fatty acids contribute to proinflammatory gene induction in tissue-embedded immune cells. However, it is unknown how circulating monocytes, the macrophage precursors, react to high-fat environments. In macrophages, saturated fatty
Qiyun Zhong et al.
PLoS biology, 18(12), e3000986-e3000986 (2020-12-31)
Clustering of the enteropathogenic Escherichia coli (EPEC) type III secretion system (T3SS) effector translocated intimin receptor (Tir) by intimin leads to actin polymerisation and pyroptotic cell death in macrophages. The effect of Tir clustering on the viability of EPEC-infected intestinal
Jeanie Quach et al.
Mucosal immunology, 12(2), 323-339 (2018-10-27)
During invasion, Entamoeba histolytica (Eh) encounter macrophages and activate them to elicit tissue damaging pro-inflammatory responses. When Eh binds macrophages via the Gal-lectin, surface EhCP-A5 RGD sequence ligates α5β1 integrin to activate caspase-1 in a complex known as the NLRP3

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica