Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU155731

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR7

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Pelin Kaya et al.
Nutrients, 11(2) (2019-02-20)
Curcumae radix is the dry root of Curcuma longa L. (turmeric) that can be used either as a spice or traditional medicine. The aim of this study was to investigate the survival benefits and the anti-metastatic activity of curcumae radix
Bing Xu et al.
Cancer medicine, 6(5), 1062-1071 (2017-04-06)
Chemokine and the chemokine receptor have a key role in the tumor progress. Here, we supposed that CCR7 might induce the invasion, migration, and epithelial-mesenchymal transition (EMT) process of breast cancer. In this research, human breast cancer MCF-7 and MDA-MB-231cells
Lin-Hui Yuan et al.
International journal of ophthalmology, 10(6), 862-869 (2017-07-22)
To investigate the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced retinopathy (OIR). Neonatal C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR control (treated with scramble siRNA), and OIR treated (treated with CCR7 siRNA). Normoxia
Fei Li et al.
Medical oncology (Northwood, London, England), 31(9), 180-180 (2014-08-22)
Secondary lymphoid tissue chemokine (SLC/CCL21) and its receptor CCR7 have been implicated in lymph node metastasis, whereas the mechanism of which remains unclear. Epithelial-mesenchymal transition (EMT) plays an important role in invasion and migration of cancer cells. We presumed that
Kaori Kubo et al.
Biochemical and biophysical research communications, 463(4), 825-831 (2015-06-24)
Chronic myeloid leukemia is a clonal disease characterized by the presence of the Philadelphia chromosome and its oncogenic product, BCR-ABL, which activates multiple pathways involved in cell survival, growth promotion, and disease progression. We previously reported that in murine hematopoietic

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica