Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU155191

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN11 (2)

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTCATTCTGCTGGCTCTCTGCGCCCTTGTTGCCACCATCTGGTTCCCTGTGTGCGCCCACCGTGAGACCACCATCGTGAGCTTTGGCTACTCCCTGTATGCAGGCTGGATTGGTGCTGTGCTGTGCCTCGTGGGTGGCTGTGTCATCCTCTGCTGCGCTGGAGATGCCCAGGCCTTTGGTGAAAACCGTTTCTACTACACTGCGGGCTCTAGCTCCCCGACTCATGCGAAGAGTGCCCACGTATAAGAGGGCTGCCCGGCTGCCCACAGAGGTGCTGTAGATGCTGGGCCCAGGGCCCTAGGTTTGCTCGTCACAGTGTGGGGAAGCCCATTCCTCTGCCAGGCTCTAAAGCCAAAGGTCTAGAAAAGCATCCTGTCTGGCATTTTGTAGTCTTAACTTCTCCCCATTTCCCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nami O Yamada et al.
International journal of molecular sciences, 20(18) (2019-09-11)
Extracellular vesicles (EVs) are nanometer-sized membranous vesicles used for primitive cell-to-cell communication. We previously reported that colon cancer-derived EVs contain abundant miR-92a-3p and have a pro-angiogenic function. We previously identified Dickkopf-3 (Dkk-3) as a direct target of miR-92a-3p; however, the
Fabian Horné et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(9), 1181-1192 (2018-12-06)
Claudins are the major components of tight junctions and are often deregulated in human cancer, permitting escape of cancer cells along with the acquisition of invasive properties. Similarly, endometrial cells also show invasive capabilities; however, the role of tight junctions

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica