Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU153321

Sigma-Aldrich

MISSION® esiRNA

targeting human CCND1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCA

Ensembl | Número de adesão de ser humano

ENSG00000110092

nº de adesão NCBI

NM_053056

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CCND1(595) , CCND1(595)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaohong Jiang et al.
Gene therapy, 27(12), 557-566 (2020-06-07)
LncRNAs are reported to participate in the progression of various diseases including diabetic nephropathy. Currently, we reported that SNHG16 was obviously upregulated in db/db mice and high glucose-treated mice mesangial cells. Then, functional experiments showed that SNHG16 silencing significantly inhibited
Dexin Yin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(4), 1499-1511 (2018-09-12)
Recent studies have suggested that several lncRNAs contribute to the angiogenic function of endothelial cells. Herein, we set out to reveal whether lncRNA UCA1 has functions in endothelial angiogenesis. The expression levels of lncRNA UCA1, miR-195 and CCND1 in human
Mingming Wang et al.
Journal of cellular physiology, 235(2), 1588-1600 (2019-07-17)
Prostate cancer (PCa) is one of the major health problems of the aging male. The roles of dysregulated microRNAs in PCa remain unclear. In this study, we mined the public published data and found that miR-487a-3p was significantly downregulated in
Chuanyong Wu et al.
Journal of Cancer, 11(7), 1959-1967 (2020-03-21)
Accumulating evidences showed that aberrantly expressed long noncoding RNAs (lncRNAs) have critical roles in many cancers. However, the expression and roles of a poorly studied lncRNA PCNA-AS1 in non-small-cell lung cancer (NSCLC) remain unknown. In this study, we investigated the
Outhiriaradjou Benard et al.
Molecular cancer research : MCR, 17(7), 1571-1581 (2019-04-11)
Cancer stem cells (CSC) generate and sustain tumors due to tumor-initiating potential, resulting in recurrence or metastasis. We showed that knockout of the cell-cycle inhibitor, p21CIP1, in the PyMT mammary tumor model inhibits metastasis; however the mechanism remained unknown. Here
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica