Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU151801

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGAAGGATCTCGGCCAATTTGGGGTTTTGGGTTTTGGCTTCGTTTCTTCTCTTCGTTGACTTTGGGGTTCAGGTGCCCCAGCTGCTTCGGGCTGCCGAGGACCTTCTGGGCCCCCACATTAATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACC

Ensembl | Número de adesão de ser humano

ENSG00000136826

nº de adesão NCBI

NM_004235

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KLF4(9314) , KLF4(9314)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
NAV
UTU
ITU
JQU
AJU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Bing Li et al.
Human gene therapy, 30(3), 339-351 (2018-09-13)
Kallistatin (KS) has been recognized as a plasma protein with anti-inflammatory functions. Macrophages are the primary inflammatory cells in atherosclerotic plaques. However, it is unknown whether KS plays a role in macrophage development and the pathogenesis of atherosclerosis. This study
Hong Lok Lung et al.
Scientific reports, 9(1), 12064-12064 (2019-08-21)
We and others have previously shown that the canonical nuclear factor kappa-B (NF-κB) pathway is essential to nasopharyngeal carcinoma (NPC) tumor development and angiogenesis, suggesting that the NF-κB pathway, including its upstream modulators and downstream effectors, are potential therapeutic targets
Guodong Tang et al.
Oncotarget, 7(49), 81757-81767 (2016-11-12)
In this study, our findings indicated that FOXO1 expression frequently decreased in glioma tissues and cells. FOXO1 expression decrease correlated with glioma progression and predicted a worse overall survival of glioma patients. Restored FOXO1 expression inhibited glioma cells invasion and
Scott Bell et al.
American journal of human genetics, 104(5), 815-834 (2019-04-30)
We identified individuals with variations in ACTL6B, a component of the chromatin remodeling machinery including the BAF complex. Ten individuals harbored bi-allelic mutations and presented with global developmental delay, epileptic encephalopathy, and spasticity, and ten individuals with de novo heterozygous
Maisa C Takenaka et al.
Nature neuroscience, 22(5), 729-740 (2019-04-10)
Tumor-associated macrophages (TAMs) play an important role in the immune response to cancer, but the mechanisms by which the tumor microenvironment controls TAMs and T cell immunity are not completely understood. Here we report that kynurenine produced by glioblastoma cells
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica