Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU151791

Sigma-Aldrich

MISSION® esiRNA

targeting human NECTIN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTCAATCTCACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAGAAGGGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCCAGTGTGGTATCCTGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAACCCCAATGGCACAGTGACGGTCATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCACCAGCAGTCCTTGGCCTGCATCGTCAACTACCACATGGACCGCTTCAAGGAAAGCCTCACTCTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGGTTTGATGGCAACTGGTACCTGCAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTA

Ensembl | Número de adesão de ser humano

ENSG00000110400

nº de adesão NCBI

NM_002855

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NECTIN1(5818) , PVRL1(5818)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
WNS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Caixia Li et al.
American journal of physiology. Endocrinology and metabolism, 309(3), E302-E310 (2015-06-18)
High glucose reduces autophagy and enhances apoptosis of podocytes. Previously, we reported that high glucose induced podocyte injury through upregulation of the (pro)renin receptor (PRR). We hypothesized that increasing PRR reduces autophagy and increases apoptosis of mouse podocytes exposed to

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica