Todas as fotos(1)

Documentos Principais

EHU149771

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human T

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

Nível de qualidade

100

linha de produto

MISSION^®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATGGGGGTGGCTTCTTCCTGGAACCAGCACCCTGTGTCCACCTGCAAATCCTCATCCTCAGTTTGGAGGTGCCCTCTCCCTCCCCTCCACGCACAGCTGTGACAGGTACCCAACCCTGAGGAGCCACCGGTCCTCACCCTACCCCAGCCCCTATGCTCATCGGAACAATTCTCCAACCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTG

Ensembl | Número de adesão de ser humano

ENSG00000164458

nº de adesão NCBI

NM_003181

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... T(6862) , T(6862)

Categorias relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

RORα and 25-Hydroxycholesterol Crosstalk Regulates Lipid Droplet Homeostasis in Macrophages.

Zewen Kelvin Tuong et al.

PloS one, 11(1), e0147179-e0147179 (2016-01-27)

Nuclear hormone receptors have important roles in the regulation of metabolic and inflammatory pathways. The retinoid-related orphan receptor alpha (Rorα)-deficient staggerer (sg/sg) mice display several phenotypes indicative of aberrant lipid metabolism, including dyslipidemia, and increased susceptibility to atherosclerosis. In this

TonEBP modulates the protective effect of taurine in ischemia-induced cytotoxicity in cardiomyocytes.

Y J Yang et al.

Cell death & disease, 6, e2025-e2025 (2015-12-18)

Taurine, which is found at high concentration in the heart, exerts several protective actions on myocardium. Physically, the high level of taurine in heart is maintained by a taurine transporter (TauT), the expression of which is suppressed under ischemic insult.

Cardiac hypertrophy is positively regulated by long non-coding RNA PVT1.

Yi-Hui Yu et al.

International journal of clinical and experimental pathology, 8(3), 2582-2589 (2015-06-06)

The aim of this study was to determine whether long non-coding RNA PVT1 can participate in the regulation of cardiac hypertrophy. A C57BL/6 mouse cardiac hypertrophic model was established using transverse aortic constriction (TAC). The animals subjected to sham operation

Protein phosphatase 2C-alpha knockdown reduces angiotensin II-mediated skeletal muscle wasting via restoration of mitochondrial recycling and function.

Alexander Michael Tabony et al.

Skeletal muscle, 4, 20-20 (2015-01-28)

Circulating angiotensin II (AngII) is elevated in congestive heart failure (CHF), and leads to skeletal muscle wasting, which is strongly associated with poor patient outcomes. We previously found that AngII upregulates protein phosphatase 2C-alpha (PP2Cα) and dephosphorylates AMP-activated protein kinase

Mineralization of three-dimensional osteoblast cultures is enhanced by the interaction of 1α,25-dihydroxyvitamin D3 and BMP2 via two specific vitamin D receptors.

Jiaxuan Chen et al.

Journal of tissue engineering and regenerative medicine, 10(1), 40-51 (2013-06-21)

1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] and bone morphogenetic protein-2 (BMP2) are both used to stimulate osteoblastic differentiation. 1α,25(OH)2D3 regulates osteoblasts through classical steroid hormone receptor mechanisms and through rapid responses that are mediated by two receptors, the traditional vitamin D receptor (VDR)

Exibir todos os documentos relacionados

Global Trade Item Number

SKU	GTIN
EHU149771-20UG	4061831366259
EHU149771-50UG	4061828406364

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica