Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU148491

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1C2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TAGCCTGTGAGGGAGGAAGAAACATTTGCTAACCAGGCCAGTGACAGAAATGGATTCGAAATACCAGTGTGTGAAGCTGAATGATGGTCACTTCATGCCTGTCCTGGGATTTGGCACCTATGCGCCTGCAGAGGTTCCTAAAAGTAAAGCTCTAGAGGCCGTCAAATTGGCAATAGAAGCCGGGTTCCACCATATTGATTCTGCACATGTTTACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGAGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAGGTCACTGAAAAATCTTCAATTGGACTATGTTGACCTCTATCTTATTCATTTTCCAGTGTCTGTAAAGCCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGACACAGTGGATCTCTGTGCCACATG

Ensembl | Número de adesão de ser humano

ENSG00000151632

nº de adesão NCBI

NM_001135241

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AKR1C2(1646) , AKR1C2(1646)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Akitomi Shirato et al.
Oncology letters, 7(3), 674-678 (2014-02-15)
Cisplatin is currently the most effective anti-tumor agent available against bladder cancer. To clarify the mechanism underlying cisplatin resistance in bladder cancer, the present study examined the role of the aldo-keto reductase family 1 member C2 (AKR1C2) protein on chemoresistance
Viktor Hlaváč et al.
Medicine, 93(28), e255-e255 (2014-12-20)
Metabolism of anticancer drugs affects their antitumor effects. This study has investigated the associations of gene expression of enzymes metabolizing anticancer drugs with therapy response and survival of breast carcinoma patients. Gene expression of 13 aldo-keto reductases (AKRs), carbonyl reductase
Feng Huang et al.
Journal of cancer research and clinical oncology, 140(11), 1835-1848 (2014-06-19)
This study was designed to investigate the role of PDGF-DD secreted by gastric cancer-derived mesenchymal stem cells (GC-MSCs) in human gastric cancer progression. Gastric cancer cells were indirectly co-cultured with GC-MSCs in a transwell system. The growth and migration of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica