Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU147931

Sigma-Aldrich

MISSION® esiRNA

targeting human AREG

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAACTGAAGATAAAATTACAGGATATCACATTGGAGTCACTGCCAAGTCATAGCCA

Ensembl | Número de adesão de ser humano

ENSG00000109321

nº de adesão NCBI

NM_001657

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AREG(374) , AREG(374)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
IRS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian Wang et al.
Cellular signalling, 53, 122-131 (2018-10-07)
Ambient particulate matter (PM) promotes the development and exacerbation of chronic respiratory diseases, including chronic obstructive pulmonary disease (COPD) and asthma, by increasing inflammation and mucus hypersecretion. However, the biological mechanisms underlying PM-induced airway inflammation and mucus hypersecretion remain unclear.
Simona Taverna et al.
Scientific reports, 7(1), 3170-3170 (2017-06-11)
Non-small cell lung cancer (NSCLC) remains the leading cause of cancer-related deaths worldwide. The majority of patients are diagnosed in advanced disease stage. Bone metastasis is the most frequent complication in NSCLC resulting in osteolytic lesions. The perfect balance between
Shuntaro Tokunaga et al.
Anticancer research, 37(5), 2225-2231 (2017-05-10)
Amrubicin (AMR) has shown promising activity for lung cancer. However, little is known about the mechanism underlying resistance to this agent. The aim of this study was to elucidate the mechanism underlying resistance to AMR. We first developed amrubicinol (AMR-OH)-resistant
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica