Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU147511

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAA

Ensembl | Número de adesão de ser humano

ENSG00000175104

nº de adesão NCBI

NM_004620

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TRAF6(7189) , TRAF6(7189)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XZU
KXU
OWU
DUU
IYT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Quanfeng Wu et al.
Cancer cell international, 17, 62-62 (2017-06-09)
To study the mechanism by which epithelial ovarian cancer (EOC)-derived exosomes restore the migration of endothelial cells that is suppressed by TAM-derived exosomes. Exosomes were isolated from TAMs in the ascites of patients with EOC. The effect of exosomes on
Yancan Liang et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 47(6), 583-589 (2018-03-27)
Tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) has been proved to play an important role in tumorigenesis, invasion, and metastasis. However, its precise role salivary adenoid cystic carcinoma (SACC) has not been determined. The aim of this study was
Ge Song et al.
Frontiers in immunology, 12, 649020-649020 (2021-03-16)
Myeloid-derived suppressor cells (MDSCs) are immature heterogeneous cells derived from the bone marrow and they are the major component of the tumor-induced immunosuppressive environment. Tumor necrosis factor receptor-associated factor 6 (TRAF6), an E3 ubiquitin ligase, catalyzes the polyubiquitination of target
Eugenia M Yazlovitskaya et al.
Matrix biology : journal of the International Society for Matrix Biology, 77, 101-116 (2018-09-09)
Integrins, the major receptors for cell-extracellular matrix (ECM) interactions, regulate multiple cell biological processes including adhesion, migration, proliferation and growth factor-dependent signaling. The principal laminin (LM) binding integrins α3β1, α6β1 and α6β4 are usually co-expressed in cells and bind to
Carrie M Rosenberger et al.
PLoS pathogens, 13(4), e1006305-e1006305 (2017-04-06)
Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica