Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU147451

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF31, RP11-468E2.4

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCTTGAAGGAGAAGCACATCACAGACATGGTGTGCCCTGCCTGTGGCCGCCCCGACCTCACCGATGACACACAGTTGCTCAGCTACTTCTCTACCCTTGACATCCAGCTTCGCGAGAGCCTAGAGCCAGATGCCTATGCGTTGTTCCATAAGAAGCTGACCGAGGGTGTGCTGATGCGGGACCCCAAGTTCTTGTGGTGTGCCCAGTGCTCCTTTGGCTTCATATATGAGCGTGAGCAGCTGGAGGCAACTTGTCCCCAGTGTCACCAGACCTTCTGTGTGCGCTGCAAGCGCCAGTGGGAGGAGCAGCACCGAGGTCGGAGCTGTGAGGACTTCCAGAACTGGAAACGCATGAACGACCCAGAATACCAGGCCCAGGGCCTAGCAATGTATCTTCAGGAAAACGGCATTGACTGCCCCAAATGCAAGTTCTCGTACGCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed
Eva M van Well et al.
The EMBO journal, 38(9) (2019-03-20)
Neurodegenerative diseases are characterized by the accumulation of misfolded proteins in the brain. Insights into protein quality control mechanisms to prevent neuronal dysfunction and cell death are crucial in developing causal therapies. Here, we report that various disease-associated protein aggregates

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica