Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU145511

Sigma-Aldrich

MISSION® esiRNA

targeting human STAG2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCTATGCAGTCGGTGGTAGATGATTGGATAGAATCATACAAGCATGACCGAGATATAGCACTTCTTGACCTTATCAACTTTTTTATTCAGTGTTCAGGCTGTAAAGGAGTTGTCACAGCAGAAATGTTTAGACATATGCAGAACTCTGAGATAATTCGAAAAATGACTGAAGAATTCGATGAGGATAGTGGAGATTATCCACTTACCATGGCTGGTCCTCAGTGGAAGAAGTTCAAATCCAGTTTTTGTGAATTCATTGGCGTGTTAGTACGGCAATGTCAATATAGTATCATATATGATGAGTATATGATGGATACAGTCATTTCACTTCTTACAGGATTGTCTGACTCACAAGTCAGAGCATTTCGACATACAAGCACCCTGGCAGCTATGAAGTTGATGACAGCTTTGGTGAATGTGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Gourish Mondal et al.
Nature communications, 10(1), 1686-1686 (2019-04-13)
Cohesin is a multiprotein ring that is responsible for cohesion of sister chromatids and formation of DNA loops to regulate gene expression. Genomic analyses have identified that the cohesin subunit STAG2 is frequently inactivated by mutations in cancer. However, the
Marianna Kleyman et al.
Journal of cell science, 127(Pt 19), 4225-4233 (2014-07-31)
Mutations in the STAG2 gene are present in ∼20% of tumors from different tissues of origin. STAG2 encodes a subunit of the cohesin complex, and tumors with loss-of-function mutations are usually aneuploid and display elevated frequencies of lagging chromosomes during

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica