Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU144891

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGG

Ensembl | Número de adesão de ser humano

ENSG00000125266

nº de adesão NCBI

NM_004093

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... EFNB2(1948) , EFNB2(1948)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
LCU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Maha Coucha et al.
PloS one, 14(1), e0210523-e0210523 (2019-01-09)
We have previously shown that diabetes causes dysfunctional cerebral neovascularization that increases the risk for cerebrovascular disorders such as stroke and cognitive impairment. Pericytes (PCs) play a pivotal role in the angiogenic process through their interaction with the endothelial cells
Feng Zhu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109972-109972 (2020-02-10)
Ephrin-2 (EFNB2) is expressed at abnormally high levels in some neoplasms, such as squamous cell carcinoma of the head and neck and colorectal cancer. Its overexpression is associated with the malignant progression of tumors. However, the expression of EFNB2 in
Shilpa Bhatia et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4539-4550 (2018-06-01)
Purpose: The clinical success of targeted therapies such as cetuximab and radiotherapy (RT) is hampered by the low response rates and development of therapeutic resistance. In the current study, we investigated the involvement of EphB4-ephrin-B2 protumorigenic signaling in mediating resistance
Eri Sasabe et al.
PloS one, 12(11), e0188965-e0188965 (2017-12-01)
Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck and frequently metastasizes to cervical lymph nodes. Aggressive local invasion and metastasis of OSCC are significant factors for poor prognosis. In this study, we investigated
Yan Hu et al.
Neuroscience bulletin, 30(3), 425-432 (2014-01-31)
Postmitotic neurons in the neocortex migrate to appropriate positions and form layered structures of nascent cortex during brain development. The migration of these neurons requires precise control and coordination of a large number of molecules such as axon guidance cues.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica