Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU144441

Sigma-Aldrich

MISSION® esiRNA

targeting human SNX5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCTCGCTTCAGATTGACATACCTGATGCGCTCAGTGAGAGAGACAAAGTCAAATTTACAGTGCACACAAAGACCACACTGCCCACGTTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGGCTACATGACACTCTTATTGAAACAACAGACTATGCTGGGCTTATTATTCCACCTGCTCCTACGAAGCCCGACTTTGATGGTCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGTGAAGGGTCTATGACCAAAGAAGAATTTGCCAAGATGAAACAAGAACTGGAAGCTGAGTATCTCGCTGTGTTTAAGAAGACTGTGTCCTCCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGATCGCAACTTTCATGTTTTCCTGGAATATGATCAGGATCTAAGTGTTAGGCGGAAAAATACTAAAGAGATGTTTGGTGGCTTCTTCAAA

Ensembl | Número de adesão de ser humano

ENSG00000089006

nº de adesão NCBI

NM_014426

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SNX5(27131) , SNX5(27131)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nao Itai et al.
PloS one, 13(11), e0207205-e0207205 (2018-11-13)
Sorting nexin 5 (SNX5), a member of sorting nexin family, plays an important role in membrane trafficking, including the retrograde trafficking of the cation independent mannose 6-phosphate receptor (CI-M6PR) and macropinocytosis. Using ESI-LCMS/MS analysis, we confirmed that SNX5 serine 226
Jinyang Cai et al.
Journal of Cancer, 10(13), 2942-2952 (2019-07-10)
Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide. Long-term survival rates in patients with HNSCC have not increased significantly in the past 30 years. Therefore, looking for novel molecular targets that control HNSCC progression
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica