Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU141461

Sigma-Aldrich

MISSION® esiRNA

targeting human RELA

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCCTCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTCTATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAATCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTGAATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCCTCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACACTGCCGAGCTCAAGAT

Ensembl | Número de adesão de ser humano

ENSG00000173039

nº de adesão NCBI

NM_001145138

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RELA(5970) , RELA(5970)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
CVU
HRU
DPU
MCU
IYT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiu-Lei Zhang et al.
Biochimica et biophysica acta. General subjects, 1863(10), 1443-1457 (2019-05-20)
Lung cancer is the leading cause of global cancer deaths. Current chemotherapeutic agents for lung cancer treatment are generally accompanied with severe side effects. Here, we report that marchantin C (Mar-C), a potential natural compound with little chemotherapeutic toxicity, exerts
Zhi-Yuan Li et al.
Aging, 8(10), 2337-2354 (2016-10-08)
The corneal epithelium plays important roles in the maintenance of corneal transparency for good vision, and acts as a protective barrier against foreign insults. Structural and functional changes with aging in the corneal epithelium have been documented. Here we found
Masayuki Hiraki et al.
Signal transduction and targeted therapy, 3, 13-13 (2018-05-16)
B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in
Ichiro Yajima et al.
Archives of toxicology, 91(11), 3507-3516 (2017-05-05)
Chronic exposure to arsenic is associated with various diseases in humans. Skin hyperpigmentation is the most sensitive objective symptom for patients with arsenicosis. However, there is very limited information about the mechanism of arsenic-mediated skin hyperpigmentation in vivo. In this
Qiang Liu et al.
Nephron, 139(4), 349-358 (2018-05-24)
Given the importance of neutrophil recruitment in the pathogenesis of glomerulonephritis (GN), the representative neutrophil chemoattractant C-X-C motif chemokine 1 (CXCL1)/GROα and the adhesion molecule E-selectin in glomerular endothelial cells (GECs) play a pivotal role in the development of GN.
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica