Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU141291

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGAGATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAAAGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT

Ensembl | Número de adesão de ser humano

ENSG00000097007

nº de adesão NCBI

NM_005157

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ABL1(25) , ABL1(25)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Remant Kc et al.
Stem cells and development, 28(11), 734-744 (2018-12-27)
Nonviral gene therapy with specific short interfering RNAs (siRNAs) against BCR-Abl can be an alternative and/or supportive therapy of chronic myeloid leukemia (CML) with tyrosine kinase inhibitors (TKIs), given the often observed resistance to TKIs in clinical setting. In this
X Wang et al.
Scientific reports, 8(1), 1002-1002 (2018-01-19)
Exploration of human pulmonary artery endothelial cell (EC) as a prototypical biomechanical system has important pathophysiologic relevance because this cell type plays a key role in the development of a wide variety of clinical conditions. The complex hierarchical organization ranging
Stephen D S McCarthy et al.
Journal of acquired immune deficiency syndromes (1999), 82(4), 407-415 (2019-10-29)
Previous studies support dasatinib as a potent inhibitor of HIV-1 replication. However, a functional distinction between 2 kinase targets of the drug, ABL1 and ARG, has not been assessed. We used primary CD4 T-cells, CD8-depleted peripheral blood mononuclear cells (PBMCs)
K C Remant et al.
Journal of biomedical materials research. Part A, 108(3), 565-580 (2019-11-13)
Synthetic siRNA technology has emerged as a promising approach for molecular therapy of cancer but, despite its potential for post-transcriptional gene silencing, there is an urgent need to develop efficient delivery systems particularly for difficult-to-transfect, anchorage-independent cells. In this study
Alicia N Rizzo et al.
Vascular pharmacology, 128-129, 106677-106677 (2020-04-03)
Acute Respiratory Distress Syndrome (ARDS) is a devastating disease process that involves dysregulated inflammation and decreased alveolar-capillary barrier function. Despite increased understanding of the pathophysiology, no effective targeted therapies exist to treat ARDS. Recent preclinical studies suggest that the multi-tyrosine
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica