Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU140771

Sigma-Aldrich

MISSION® esiRNA

targeting human ANO1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GATGCCGACGAAGAAGATGTACCACATTAATGAGACCCGTGGCCTCCTGAAAAAAATCAACTCTGTGCTCCAGAAAATCACAGATCCCATCCAGCCCAAAGTGGCTGAGCACAGGCCCCAGACCATGAAGAGACTCTCCTATCCCTTCTCCCGGGAGAAGCAGCATCTATTTGACTTGTCTGATAAGGATTCCTTTTTCGACAGCAAAACCCGGAGCACGATTGTCTATGAGATCTTGAAGAGAACGACGTGTACAAAGGCCAAGTACAGCATGGGCATCACGAGCCTGCTGGCCAATGGTGTGTACGCGGCTGCATACCCACTGCACGATGGAGACTACAACGGTGAAAACGTCGAGTTCAACGACAGAAAACTCCTGTACGAAGAGTGGGCACGCTATGGAGTTTTCTATAAGTACCAGCCCATCGACC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chuantao Zhang et al.
International journal of clinical oncology, 25(6), 1145-1154 (2020-04-03)
Increase of the Ca2+-activated chloride channel TMEM16A is contribute to tumorigenesis. However, the expression level of TMEM16A and its underlying molecular mechanism for TMEM16Apromotingliver carcinogenesis is remains unknown. In the present study, the expression of TMEM16A in hepatocellular carcinoma (HCC)
Huan Lian et al.
Biochemical and biophysical research communications, 487(2), 201-208 (2017-04-11)
Diabetic nephropathy (DN) is one of the most common microvascular complication of diabetes mellitus (DM) as well as the main reason resulting in chronic renal failure. Transmembrane protein 16A (TMEM16A) plays an important role in multiple physiological actions. Here we
Hui Wang et al.
Cancer letters, 455, 48-59 (2019-05-03)
The Ca2+-activated chloride channel TMEM16A (anoctamin 1) is overexpressed in breast cancer. It remains unclear how TMEM16A overexpression plays a role in carcinogenesis in breast cancer. In this study, we found that high TMEM16A expression in combination with high EGFR
Shenbin Liu et al.
British journal of pharmacology, 173(7), 1208-1218 (2016-01-13)
TMEM16A, also known as anoctamin 1 channel, is a member of the Ca(2+)-activated chloride channels family and serves as a heat sensor in the primary nociceptors. Eact is a recently discovered small molecule activator of the TMEM16A channel. Here, we
Fanning Zeng et al.
PloS one, 7(10), e47686-e47686 (2012-11-08)
GPR39 is a GPCR implicated as a regulator of gastrointestinal motility, although the mechanism remains elusive. Here, we report that GPR39 is expressed by a specific cell population cultured from mouse small intestine muscle layers, which was subsequently identified as

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica