Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU140621

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTCAGTTGGGCCTTCATAAACACTCACCTGGCTGGCTTTGCCTTCCAGGAGGAAGCTGGCTGAAGCAAGGGTGTGGAATTTTAAATGTGTGCACAGTCTGGAAAACTGTCAGAATCAGTTTTCCCATAAAAGGGTGGGCTAGCATTGCAGCTGCATTTGGGACCATTCAAATCTGTCACTCTCTTGTGTATATTCCTGTGCTATTAAATATATCAGGGCAGTGCATGTAAATCATCCTGATATATTTAATATATTTATTATATTGTCCCCCGAGGTGGGGACAGTGAGTGAGTTCTCTTAGTCCCCCCAGAGCTGGTTGTTAAAGAGCCTGGCACCTACCCGCTCTCACTTCATCTGTGTCATCTCTGCACACTCCAGCCCACTTTCTGCCTTCAGCCAT

Ensembl | Número de adesão de ser humano

ENSG00000128604

nº de adesão NCBI

NM_001098627

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IRF5(3663) , IRF5(3663)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kang Sun et al.
World journal of gastroenterology, 22(42), 9368-9377 (2016-11-30)
To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in
Hongbin Cai et al.
Biochemical and biophysical research communications, 492(2), 192-198 (2017-08-19)
Ischemia-reperfusion injury (IRI) has been implicated in many pathological conditions, including cardiovascular diseases. Adhesion of leukocytes to the surface of endothelial cells has been considered as one of the principle steps in the pathological cascade of inflammatory tissue damage during
Jihyun Yang et al.
Journal of cellular physiology, 234(12), 23033-23042 (2019-05-28)
Bone-resorbing osteoclasts are differentiated from macrophages (MΦ) by M-CSF and RANKL. MΦ can be mainly classified into M1 and M2 MΦ, which are proinflammatory and anti-inflammatory, respectively, but little is known about their osteoclastogenic potential. Here, we investigated the osteoclastogenic
Ratana Lim et al.
Reproduction (Cambridge, England), 156(3), 207-218 (2018-07-15)
Preterm birth continues to be the leading cause of neonatal mortality and morbidities that can extend into adult life. Few treatment options stem from our incomplete understanding of the mechanisms of human labour and delivery. Activation of the inflammatory response
Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 202(3), 920-930 (2018-12-30)
Common IFN regulatory factor 5 (IRF5) variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern recognition receptor (PRR)-induced cytokines in macrophages. PRR-initiated pathways also contribute to bacterial clearance, and dysregulation of bacterial clearance can
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica