Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU134551

Sigma-Aldrich

MISSION® esiRNA

targeting human NRP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCCTGAACTACCCTGAGAATGGGTGGACTCCCGGAGAGGATTCCTACCGAGAGTGGATACAGGTAGACTTGGGCCTTCTGCGCTTTGTCACGGCTGTCGGGACACAGGGCGCCATTTCAAAAGAAACCAAGAAGAAATATTATGTCAAGACTTACAAGATCGACGTTAGCTCCAACGGGGAAGACTGGATCACCATAAAAGAAGGAAACAAACCTGTTCTCTTTCAGGGAAACACCAACCCCACAGATGTTGTGGTTGCAGTATTCCCCAAACCACTGATAACTCGATTTGTCCGAATCAAGCCTGCAACTTGGGAAACTGGCATATCTATGAGATTTGAAGTATACGGTTGCAAGATAACAGATTATCCTTGCTCTGGAATGTTGGGTATGGTGTCTGGA

Ensembl | Número de adesão de ser humano

ENSG00000099250

nº de adesão NCBI

NM_001024628

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NRP1(8829) , NRP1(8829)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
NXT
BJS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rebecca McLennan et al.
Developmental biology, 407(1), 12-25 (2015-08-19)
Embryonic neural crest cells travel in discrete streams to precise locations throughout the head and body. We previously showed that cranial neural crest cells respond chemotactically to vascular endothelial growth factor (VEGF) and that cells within the migratory front have
Pezhman Salehi et al.
PLoS genetics, 13(10), e1007048-e1007048 (2017-10-24)
Neuropilin-1 (Nrp1) encodes the transmembrane cellular receptor neuropilin-1, which is associated with cardiovascular and neuronal development and was within the peak SNP interval on chromosome 8 in our prior GWAS study on age-related hearing loss (ARHL) in mice. In this
Toru Nakanishi et al.
Cell death & disease, 10(2), 67-67 (2019-01-27)
Following incomplete spinal cord injury (SCI), reorganization of the corticospinal tract (CST) contributes to spontaneous motor recovery. Axotomized CST fibers form collaterals and make synapses with interneurons, followed by pruning of excess fibers. Although axonal pruning is involved in refinement
Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Anthony Ambesi et al.
Journal of cell science, 127(Pt 17), 3805-3816 (2014-07-02)
The fibronectin matrix plays a crucial role in the regulation of angiogenesis during development, tissue repair and pathogenesis. Previous work has identified a fibronectin-derived homophilic binding peptide, anastellin, as an effective inhibitor of angiogenesis; however, its mechanism of action is
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica