Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU130641

Sigma-Aldrich

MISSION® esiRNA

targeting human SORT1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCCTGGGTTGGAGATAGCACTGGGGTCATTCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCCAAGCTATATCGAAGTGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCGGACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAGGTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCAGATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATGTATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAAAATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTATGTTTGGCCAAATGGGGATCAGACAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTG

Ensembl | Número de adesão de ser humano

ENSG00000134243

nº de adesão NCBI

NM_002959

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SORT1(6272) , SORT1(6272)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuncheng Lv et al.
Acta biochimica et biophysica Sinica, 51(5), 471-483 (2019-04-06)
Sortilin is closely associated with hyperlipidemia and the risk of atherosclerosis (AS). The role of sortilin and the underlying mechanism in peripheral macrophage are not fully understood. In this study, we investigated the effect of macrophage sortilin on ATP-binding cassette
Hye Youn Sung et al.
Journal of stroke, 20(3), 350-361 (2018-10-13)
The pathogenesis of moyamoya disease (MMD) remains poorly understood, and no reliable molecular biomarkers for MMD have been identified to date. The present study aimed to identify epigenetic biomarkers for use in the diagnosis of MMD. We performed integrated analyses
Keiji Uchiyama et al.
PLoS pathogens, 13(6), e1006470-e1006470 (2017-07-01)
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains
Swati Venkat et al.
Molecular biology of the cell, 28(19), 2569-2578 (2017-08-05)
Elevated, nontoxic doses of manganese (Mn) protect against Shiga toxin-1-induced cell death via down-regulation of GPP130, a cycling Golgi membrane protein that serves as an endosome-to-Golgi trafficking receptor for the toxin. Mn binds to GPP130 in the Golgi and causes
Fangfang Gao et al.
The American journal of pathology, 190(9), 1931-1942 (2020-06-12)
Pancreatic cancer has a dismal prognosis, and there is no targeted therapy against this malignancy. The neuronal membrane protein sortilin is emerging as a regulator of cancer cell development, but its expression and impact in pancreatic cancer are unknown. This
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica