Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU130481

Sigma-Aldrich

MISSION® esiRNA

targeting human ZFR

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TAAGGTCCACAGCTCCTGCTGTAGCTTATGATAGTAAGCAATACTACCAACAACCAACAGCAACTGCTGCTGCTGTAGCTGCCGCTGCCCAACCTCAGCCTTCTGTTGCTGAAACTTACTATCAGACAGCCCCCAAAGCAGGTTACAGCCAAGGTGCAACTCAGTATACTCAAGCCCAGCAAACTCGACAAGTGACAGCCATAAAACCAGCCACACCAAGTCCAGCTACCACTACTTTCTCCATCTATCCTGTATCCTCCACCGTACAGCCAGTAGCAGCTGCGGCTACTGTGGTGCCATCCTATACTCAGAGTGCTACTTACAGTACCACAGCAGTTACATATTCTGGTACGTCTTATTCAGGTTATGAAGCAGCAGTGTATTCAGCTGCATCTTCCTACTATCAACAGCAGCAGCAGC

Ensembl | Número de adesão de ser humano

ENSG00000056097

nº de adesão NCBI

NM_016107

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ZFR(51663) , ZFR(51663)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xindan Xing et al.
Biochemical and biophysical research communications, 512(3), 552-557 (2019-03-28)
Angiogenesis is an essential part of the diabetes retinopathy (DR) process, and Zinc Finger RNA Binding Protein (ZFR) is important for vascularization to occur. However, the function and regulation of ZFR in DR development are not well understood. We hypothesized
Yanrong Long et al.
Biochemical and biophysical research communications, 513(4), 1027-1034 (2019-04-24)
Colorectal cancer (CRC) and liver cancer are the second and fourth leading causes of cancer-related deaths in the whole world, respectively, and each year over 1.6 million people die from these diseases. To identify driver genes in CRC and liver

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica