Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130241

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAATGGTGTCTGCAAGTGGCCCGGATGTGAGAAGGTCTTCGAAGAGCCAGAGGACTTCCTCAAGCACTGCCAGGCGGACCATCTTCTGGATGAGAAGGGCAGGGCACAATGTCTCCTCCAGAGAGAGATGGTACAGTCTCTGGAGCAGCAGCTGGTGCTGGAGAAGGAGAAGCTGAGTGCCATGCAGGCCCACCTGGCTGGGAAAATGGCACTGACCAAGGCTTCATCTGTGGCATCATCCGACAAGGGCTCCTGCTGCATCGTAGCTGCTGGCAGCCAAGGCCCTGTCGTCCCAGCCTGGTCTGGCCCCCGGGAGGCCCCTGACAGCCTGTTTGCTGTCCGGAGGCACCTGTGGGGTAGCCATGGAAACAGCACATTCCCAGAGTTCCTCCACAACATGGACTACTTCAAGTTCCACAACATGCGACCCCCTTTCACCTACGCCACGCTCATCCGCTGGGCCATCCTGGAGGCTCCAGAGAAGCAGCGGACACTCAAT

Ensembl | Número de adesão de ser humano

ENSG00000049768

nº de adesão NCBI

NM_001114377

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FOXP3(50943) , FOXP3(50943)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BOS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hanwei Zhang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5349-5361 (2016-11-03)
The transcriptional regulation mediating cancer cell differentiation into distinct molecular subtypes and modulating sensitivity to existing treatments is an enticing therapeutic target. Our objective was to characterize the ability of the forkhead/winged transcription factor FOXP3 to modulate the differentiation of
Grethe Skretting et al.
Journal of cellular biochemistry, 120(8), 12924-12936 (2019-03-13)
Single nucleotide polymorphisms (SNPs) may play an important role in the risk of certain diseases. We have previously shown that the -287T/C SNP of the tissue factor pathway inhibitor (TFPI) gene promoter region exerts differential impact on TFPI mRNA expression;
Dong Fan et al.
Oncology letters, 20(6), 292-292 (2020-10-27)
Forkhead box P3 (FOXP3), an X-linked tumor suppressor gene, plays an important role in breast cancer. However, the biological functions of FOXP3 in breast cancer apoptosis remain unclear. To investigate the underlying genes and networks regulated by FOXP3 in breast
Chun Li et al.
Pathology, research and practice, 213(10), 1251-1256 (2017-09-25)
Our study aimed to investigate the biological role of FOXP3 expression in human lung adenocarcinoma (LAD) tissues and evaluate its involvement in cell proliferation and chemosensitivity to cisplatin in LAD cells. Paraffin-embedded tissues from 50 LAD patients were collected to
Maria Napolitano et al.
Oncotarget, 6(10), 8261-8270 (2015-04-01)
Short-course preoperative radiotherapy (SC-RT) followed by total mesorectal excision (TME) is one therapeutic option for locally advanced rectal cancer (LARC) patients. Since radio-induced DNA damage may affect tumor immunogenicity, Myeloid-derived suppressor cells (MDSCs) and T regulatory cells (Tregs) were evaluated
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica