Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130211

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAGCTCTCCAATCTGAAGGTCCACCTGAGAGTGCACAGTGGAGAACGGCCTTTCAAATGTCAGACTTGCAACAAGGGCTTTACTCAGCTCGCCCACCTGCAGAAACACTACCTGGTACACACGGGAGAAAAGCCACATGAATGCCAGGTCTGCCACAAGAGATTTAGCAGCACCAGCAATCTCAAGACCCACCTGCGACTCCATTCTGGAGAGAAACCATACCAATGCAAGGTGTGCCCTGCCAAGTTCACCCAGTTTGTGCACCTGAAACTGCACAAGCGTCTGCACACCCGGGAGCGGCCCCACAAGTGCTCCCAGTGCCACAAGAACTACATCCATCTCTGTAGCCTCAAGGTTCACCTGAAAGGGAACTGCGCTGCGGCCCCGGCGCCTGGGCTGCCCTTGGAAGATCTGACCCGAATC

Ensembl | Número de adesão de ser humano

ENSG00000057657

nº de adesão NCBI

NM_001198

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRDM1(639) , PRDM1(639)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ADZW
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Enzo Acerbi et al.
Scientific reports, 6, 23128-23128 (2016-03-16)
T helper 17 (TH17) cells represent a pivotal adaptive cell subset involved in multiple immune disorders in mammalian species. Deciphering the molecular interactions regulating TH17 cell differentiation is particularly critical for novel drug target discovery designed to control maladaptive inflammatory
Liuluan Zhu et al.
Journal of hematology & oncology, 10(1), 124-124 (2017-06-21)
T cell immunoglobulin and immunoreceptor tyrosine-based inhibitory motif (ITIM) domain (TIGIT) and programmed cell death protein 1 (PD-1) are important inhibitory receptors that associate with T cell exhaustion in acute myeloid leukemia (AML). In this study, we aimed to determine
Woo-Shin Kim et al.
Scientific reports, 7(1), 10626-10626 (2017-09-08)
Transglutaminase 2 (TG2) performs multiple reactions, including transamidation, and also plays a role in signal transduction as a GTP-binding protein. In this study, we reveal that TG2 controls osteoclast differentiation and bone homeostasis in mice. Osteoclasts specifically expressed the TG2
Prontip Saelee et al.
Frontiers in immunology, 8, 383-383 (2017-04-26)
The transcription factor Ets1 is highly expressed in B lymphocytes. Loss of Ets1 leads to premature B cell differentiation into antibody-secreting cells (ASCs), secretion of autoantibodies, and development of autoimmune disease. Despite the importance of Ets1 in B cell biology
Zhuoming Liu et al.
The Journal of experimental medicine, 211(6), 1197-1213 (2014-05-28)
Competition for iron influences host-pathogen interactions. Pathogens secrete small iron-binding moieties, siderophores, to acquire host iron. In response, the host secretes siderophore-binding proteins, such as lipocalin 24p3, which limit siderophore-mediated iron import into bacteria. Mammals produce 2,5-dihydroxy benzoic acid, a
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica