Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU129801

Sigma-Aldrich

MISSION® esiRNA

targeting human PRSS12

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTCACAGCAGCACACTGTTTCAAGAGGTATGGCAACAGCACTAGGAGCTATGCTGTTAGGGTTGGAGATTATCATACTCTGGTACCAGAGGAGTTTGAGGAAGAAATTGGAGTTCAACAGATTGTGATTCATCGGGAGTATCGACCCGACCGCAGTGATTATGACATAGCCCTGGTTAGATTACAAGGACCAGAAGAGCAATGTGCCAGATTCAGCAGCCATGTTTTGCCAGCCTGTTTACCACTCTGGAGAGAGAGGCCACAGAAAACAGCATCCAACTGTTACATAACAGGATGGGGTGACACAGGACGAGCCTATTCAAGAACACTACAACAAGCAGCCATTCCCTTACTTCCTAAAAGGTTTTGTGAAGAACGTTATAAGGGTCGGTTTACAGGGAGAATGCTTTGTGCTGGAAACCTCCATGAACACAAACGCGTGGACAGCTGCCAGGGAGACAGCGGAGGACCACTCATGTGTGAACGGCCCGGAGAGAGCTGGGTGGTGTATGGGGTGACCTC

Ensembl | Número de adesão de ser humano

ENSG00000164099

nº de adesão NCBI

NM_003619

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRSS12(8492) , PRSS12(8492)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ah-Rong Nam et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(3), 886-900 (2018-10-05)
Jab1 is a coactivator of c-Jun that enhances the transcriptional function of c-Jun. Jab1 is frequently overexpressed in various cancers and is associatedwith poor prognosis of cancer patients. Thus, Jab1 could be a potential therapeutic target in cancer. However, the
Judit Iván et al.
Stem cells and development, 26(23), 1724-1733 (2017-10-11)
Free fatty acid receptor 2 (FFAR2, also known as GPR43) is a G-protein-coupled receptor activated by short-chain fatty acids that are produced by gut microbiota through fermentation of nondigestible carbohydrates. FFAR2 functions as a metabolic sensor and is expressed in
J J Souchek et al.
British journal of cancer, 111(6), 1139-1149 (2014-07-16)
Despite its promise as a highly useful therapy for pancreatic cancer (PC), the addition of external beam radiation therapy to PC treatment has shown varying success in clinical trials. Understanding PC radioresistance and discovery of methods to sensitise PC to
Yang Zhang et al.
American journal of physiology. Lung cellular and molecular physiology, 307(2), L173-L185 (2014-05-20)
The inflammatory response is a primary mechanism in the pathogenesis of ventilator-induced lung injury. Autophagy is an essential, homeostatic process by which cells break down their own components. We explored the role of autophagy in the mechanisms of mechanical ventilation-induced
Shun-Yao Ko et al.
PloS one, 9(10), e110542-e110542 (2014-10-21)
Advanced glycation end products (AGEs) are produced in an irreversible non-enzymatic reaction of carbohydrates and proteins. Patients with diabetes mellitus (DM) are known to have elevated AGE levels, which is viewed as a risk factor of diabetes-related complications. In a
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica