Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU127861

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF2AK2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAGTTTGCCTTCCTGGATTTGTAAATTGTAATGACCTCAAAACTTTAGCAGTTCTTCCATCTGACTCAGGTTTGCTTCTCTGGCGGTCTTCAGAATCAACATCCACACTTCCGTGATTATCTGCGTGCATTTTGGACAAAGCTTCCAACCAGGATACGGGAAGAAGAAATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAGCAGGGAGT

Ensembl | Número de adesão de ser humano

ENSG00000055332

nº de adesão NCBI

NM_001135651

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... EIF2AK2(5610) , EIF2AK2(5610)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tae-Hun Kim et al.
Molecular medicine reports, 16(5), 7585-7590 (2017-09-26)
Kisspeptin is a protein encoded by the KISS1 gene, which has been reported to suppress the metastatic capabilities of various types of cancer cells, through the activation of its G‑protein coupled receptor GPR54. However, the molecular mechanisms underlying the involvement
Jovan Nikolic et al.
PLoS pathogens, 12(10), e1005942-e1005942 (2016-10-18)
Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress
Stephanie Dabo et al.
Scientific reports, 7(1), 16129-16129 (2017-11-25)
PKR is a cellular kinase involved in the regulation of the integrative stress response (ISR) and pro-inflammatory pathways. Two N-terminal dsRNA Binding Domains (DRBD) are required for activation of PKR, by interaction with either dsRNA or PACT, another cellular DRBD-containing
D C Tanner et al.
Cell death and differentiation, 22(9), 1489-1501 (2015-01-31)
Neuroinflammation associated with degenerative central nervous system disease and injury frequently results in oligodendrocyte death. While promoting oligodendrocyte viability is a major therapeutic goal, little is known about protective signaling strategies. We report that in highly purified rat oligodendrocytes, interferon

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica