Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU125631

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jan Rossaint et al.
The Journal of clinical investigation, 126(3), 962-974 (2016-02-16)
Chronic kidney disease (CKD) has been associated with impaired host response and increased susceptibility to infections. Leukocyte recruitment during inflammation must be tightly regulated to protect the host against pathogens. FGF23 levels are increased in blood during CKD, and levels
Jian Chen et al.
Cell death & disease, 8(10), e3090-e3090 (2017-10-06)
Therapeutics used to treat central nervous system (CNS) injury were designed to repair neurites and inhibit cell apoptosis. Previous studies have shown that neuron-derived FGF10 exerts potential neuroprotective effects after cerebral ischemia injury. However, little is known about the role
Sergei Boichuk et al.
Anti-cancer drugs, 29(6), 549-559 (2018-04-27)
The acquired resistance of gastrointestinal stromal tumors (GISTs) to the targeted-based therapy remains the driving force to identify the novel approaches that are capable of increasing the sensitivity of GISTs to the current therapeutic regimens. Our present data show that
Alok R Khandelwal et al.
Molecular carcinogenesis, 58(10), 1715-1725 (2019-06-30)
Cutaneous squamous cell carcinoma (cSCC) is a keratinocyte-derived invasive and metastatic tumor of the skin. It is the second-most commonly diagnosed form of skin cancer striking 200 000 Americans annually. Further, in organ transplant patients, there is a 65- to 100-fold
Yu Sun et al.
Experimental and therapeutic medicine, 18(2), 1440-1448 (2019-07-19)
MicroRNAs (miRNAs) are frequently dysregulated in cervical cancer, and the aberrant regulation of miRNAs may be involved in the regulation of various cancer-associated biological processes. Therefore, further exploration of the specific roles of dysregulated miRNAs in cervical cancer and their

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica