Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU122901

Sigma-Aldrich

MISSION® esiRNA

targeting human ISYNA1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCAAAGTCAAGTCCGTGCTTGTGGACTTCCTCATTGGCTCCGGCCTCAAGACCATGTCCATCGTGAGTTACAACCACCTGGGCAACAACGATGGGGAGAACCTATCGGCGCCATTGCAGTTCCGCTCTAAGGAGGTGTCCAAGAGCAACGTGGTGGACGACATGGTGCAGAGCAACCCAGTGCTCTATACGCCCGGCGAAGAGCCTGACCACTGCGTGGTCATCAAGTATGTGCCGTACGTGGGTGACAGCAAGCGCGCGCTGGATGAGTATACCTCGGAGCTGATGCTGGGCGGAACCAACACACTGGTGCTGCACAACACGTGTGAGGACTCGCTGCTGGCCGCACCCATCATGCTGGACCTAGCGCTGCTGACCGAGCTGTGCCAGCGCGTGAGCTTCTGCACTGACATGG

Ensembl | Número de adesão de ser humano

ENSG00000105655

nº de adesão NCBI

NM_016368

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ISYNA1(51477) , ISYNA1(51477)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lei Li et al.
Neuroscience letters, 672, 46-52 (2018-02-24)
The retinoic acid-inducible gene I (RIG-I) is a crucial cytoplasmic pathogen recognition receptor involved in neuroinflammation in degenerative diseases. In the present study, in vitro human astrocytes were subjected to a chemical hypoxia model using cobalt chloride pretreatment. Chemical hypoxia
Fernando D Villarreal et al.
PloS one, 10(6), e0123212-e0123212 (2015-06-13)
Myo-inositol (Ins) is a major compatible osmolyte in many cells, including those of Mozambique tilapia (Oreochromis mossambicus). Ins biosynthesis is highly up-regulated in tilapia and other euryhaline fish exposed to hyperosmotic stress. In this study, enzymatic regulation of two enzymes

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica