Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU120451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTCTTTGAACCACACAGCAAGGCAGGGACCGTGTTGTTCAGCCAGGGGGACAAGGGCACTTCGTGGTACATTATCTGGAAGGGATCTGTCAACGTGGTGACCCATGGCAAGGGGCTGGTGACCACCCTGCATGAGGGAGATGATTTTGGACAGCTGGCTCTGGTGAATGATGCACCCCGGGCAGCCACCATCATCCTGCGAGAAGACAACTGTCATTTCCTGCGTGTGGACAAGCAGGACTTCAACCGTATCATCAAGGATGTGGAGGCAAAGACCATGCGGCTGGAAGAACATGGCAAAGTGGTGCTGGTGCTGGAGAGAGCCTCTCAGGGCGCCGGCCCTTCCCGACCCCCAACCCCAGGCAGGAACCGGTATACAGTGATGTCTGGCACCCCAGAGAAGATCCTAGAGCTTCTGTTGGAGGCCATGGGACCAGATTCCAGTGCTCATGACCCAACAGAGACATTCCTCAGCGACTTCCTC

Ensembl | Número de adesão de ser humano

ENSG00000079337

nº de adesão NCBI

NM_001098531

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RAPGEF3(10411) , RAPGEF3(10411)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Li Liu et al.
Molecular vision, 23, 1-7 (2017-02-18)
Increased inflammatory mediator levels are reported in diabetic retinopathy. We previously reported that β-adrenergic receptor agonists reduced inflammatory mediators in the diabetic retina; however, these agents cannot be given systemically. Here, we investigated whether Epac1 is key to the protective
Jolanta Wiejak et al.
Biochimica et biophysica acta. Molecular cell research, 1866(2), 264-276 (2018-11-12)
Exchange protein activated by cyclic AMP (EPAC1) suppresses multiple inflammatory actions in vascular endothelial cells (VECs), partly due to its ability to induce expression of the suppressor of cytokine signalling 3 (SOCS3) gene, the protein product of which inhibits interleukin
Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Jaspal Garg et al.
Oncotarget, 8(27), 44732-44748 (2017-05-18)
Chronic stress has been associated with the progression of cancer and antagonists for β-adrenoceptors (βAR) are regarded as therapeutic option. As they are also used to treat hemangiomas as well as retinopathy of prematurity, a role of endothelial β2AR in
Jongbo Lee et al.
PLoS biology, 18(12), e3001002-e3001002 (2020-12-29)
Nucleocytoplasmic transport (NCT) defects have been implicated in neurodegenerative diseases such as C9ORF72-associated amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we identify a neuroprotective pathway of like-Sm protein 12 (LSM12) and exchange protein directly activated by cyclic AMP 1
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica