Todas as fotos(1)

Key Documents

COO/COA

EHU118761

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human ITPR3

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

Nível de qualidade

100

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCCTGTGACACTCTGTTGATGTGCATCGTCACTGTCATGAACCATGGGCTACGCAACGGTGGTGGCGTGGGCGACATTCTCCGCAAGCCCTCCAAAGATGAGTCTCTCTTCCCAGCCCGAGTGGTCTATGACCTCCTGTTCTTCTTCATCGTCATCATCATTGTGCTGAACCTCATCTTTGGGGTAATCATCGACACCTTCGCTGACCTGCGTAGTGAGAAGCAGAAGAAGGAGGAGATTCTTAAGACGACATGCTTCATCTGTGGTCTGGAGAGGGACAAGTTTGATAACAAGACAGTGTCATTTGAGGAACACATCAAGCTGGAGCACAACATGTGGAACTACTTGTACTTCATTGTGCTGGTCCGCGTGAAGAACAAGACCGACTACACGGGCCCTGAGAGCTACGTGGCCCAGATGATCAAGAACAAGAACCTGGACTGGTTCCCCCGGATGCGGGCCATGTCCCTTGTCAGCAATGAGGGCGAGGGGGAGCAGAATGAGATTCGGATTCTCCAGGACAAGCTCAACTCCACCATGA

Ensembl | Número de adesão de ser humano

ENSG00000096433

nº de adesão NCBI

NM_002224

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ITPR3(3710) , ITPR3(3709)

Categorias relacionadas

MISSION® esiRNA

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Inositol Trisphosphate Receptor Type 3-mediated Enhancement of EGFR and MET Cotargeting Efficacy in Non-Small Cell Lung Cancer Detected by 18F-fluorothymidine.

Francesca Iommelli et al.

Clinical cancer research : an official journal of the American Association for Cancer Research, 24(13), 3126-3136 (2018-04-06)

Purpose: Our aim was to test whether imaging with 18F-fluorothymidine (18F-FLT) PET/CT was able to detect the combined effects of EGFR and MET inhibitors in oncogene-driven non-small cell lung cancer (NSCLC) and to elucidate the mechanisms underlying the enhanced efficacy

Downregulation of type 3 inositol (1,4,5)-trisphosphate receptor decreases breast cancer cell migration through an oscillatory Ca

Abdallah Mound et al.

Oncotarget, 8(42), 72324-72341 (2017-10-27)

Breast cancer remains a research priority due to its invasive phenotype. Although the role of ion channels in cancer is now well established, the role of inositol (1,4,5)-trisphosphate (IP

Atheroprotective Flow Upregulates ITPR3 (Inositol 1,4,5-Trisphosphate Receptor 3) in Vascular Endothelium via KLF4 (Krüppel-Like Factor 4)-Mediated Histone Modifications.

Ming He et al.

Arteriosclerosis, thrombosis, and vascular biology, 39(5), 902-914 (2019-03-29)

Objective- The topographical distribution of atherosclerosis in vasculature underscores the importance of shear stress in regulating endothelium. With a systems approach integrating sequencing data, the current study aims to explore the link between shear stress-regulated master transcription factor and its

Ca2+ Release by IP3 Receptors Is Required to Orient the Mitotic Spindle.

Raul Lagos-Cabré et al.

Cell reports, 33(11), 108483-108483 (2020-12-17)

The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+

Role of inositol-1,4,5-trisphosphate receptor in the regulation of calcium transients in neonatal rat ventricular myocytes.

Zheng Zeng et al.

Journal of pharmacological sciences, 126(1), 37-46 (2014-09-23)

This study determined the regulatory effect of inositol 1,4,5-trisphosphate receptors (IP3Rs) on the basal Ca(2+) transients in cardiomyocytes. In cultured neonatal rat ventricular myocytes (NRVMs) at different densities, we used confocal microscopy to assess the effect of IP3Rs on the

Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica