Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU116371

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCA

Ensembl | Número de adesão de ser humano

ENSG00000182718

nº de adesão NCBI

NM_001002858

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ANXA2(302) , ANXA2(302)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BEV
ADV
KKT
FFT
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Weining Wu et al.
Journal of experimental & clinical cancer research : CR, 38(1), 133-133 (2019-03-23)
Glioblastoma multiforme (GBM) is the most common and aggressive form of astrocytoma among adult brain tumors. Multiple studies have shown that long non-coding RNAs (lncRNAs) play important roles in acting as molecular sponge for competing with microRNAs (miRNAs) to regulate
Jie Liu et al.
BMC biochemistry, 4, 10-10 (2003-09-10)
Annexin II heavy chain (also called p36, calpactin I) is lost in prostate cancers and in a majority of prostate intraepithelial neoplasia (PIN). Loss of annexin II heavy chain appears to be specific for prostate cancer since overexpression of annexin
Jiajia Chen et al.
Neuropeptides, 61, 67-76 (2016-11-12)
Annexin A2 (ANXA2), is a member of the annexin family of proteins that exhibit Ca
Zhiyang Wang et al.
Journal of cellular and molecular medicine, 22(1), 429-438 (2017-09-01)
Tenascin-c is an extracellular matrix glycoprotein, the expression of which relates to the progression of atherosclerosis, myocardial infarction and heart failure. Annexin II acts as a cell surface receptor of tenascin-c. This study aimed to delineate the role of tenascin-c
Yuanhong Chang et al.
Oncology reports, 40(6), 3625-3634 (2018-10-03)
Recently, long non-coding RNA (lncRNA) FOXD2 adjacent opposite strand RNA 1 (FOXD2-AS1) has been recognized to function as an oncogene in several human tumors, and FOXD2‑AS1 dysregulation has been closely associated with carcinogenesis and tumor progression. Nevertheless, the correlation between the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica