Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU115801

Sigma-Aldrich

MISSION® esiRNA

targeting human GSTM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAAGGCCAGGAGGTGGGAGTGAGGAGCCCATACTCAGCCTGCTGCCCAGGCTGTGCAGCGCAGCTGGACTCTGCATCCCAGCACCTGCCTCCTCGTTCCTTTCTCCTGTTTATTCCCATCTTTACTCCCAAGACTTCATTGTCCCTCTTCACTCCCCCTAAACCCCTGTCCCATGCAGGCCCTTTGAAGCCTCAGCTACCCACTATCCTTCGTGAACATCCCCTCCCATCATTACCCTTCCCTGCACTAAAGCCAGCCTGACCTTCCTTCCTGTTAGTGGTTGTGTCTGCTTTAAAGGGCCTGCCTGGCCCCTCGCCTGTGGAGCTCAGCCCCGAGCTGTCCCCGTGTTGCATGAAGGAGCAGCATTGACTGGT

Ensembl | Número de adesão de ser humano

ENSG00000134184

nº de adesão NCBI

NM_146421

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... GSTM1(2944) , GSTM1(2944)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Pritha Bhattacharjee et al.
Scientific reports, 3, 2704-2704 (2013-09-21)
The gene for glutathione-S-transferase (GST) M1 (GSTM1), a member of the GST-superfamily, is widely studied in cancer risk with regard to the homozygous deletion of the gene (GSTM1 null), leading to a lack of corresponding enzymatic activity. Many of these
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109532-109532 (2019-10-13)
Reactive oxygen species (ROS) are implicated in carcinogenesis, and cellular antioxidant systems are important for detoxifying ROS and reversing oxidant-mediated modifications. Glutathione S-transferase mu (GSTM) belongs to a family of phase II detoxification enzymes that catalyze the conjugation of reduced
Weidong Wu et al.
Particle and fibre toxicology, 9, 31-31 (2012-08-08)
Diesel exhaust particles (DEP) contribute substantially to ambient particulate matter (PM) air pollution in urban areas. Inhalation of PM has been associated with increased incidence of lung disease in susceptible populations. We have demonstrated that the glutathione S-transferase M1 (GSTM1)

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica