Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU114911

Sigma-Aldrich

MISSION® esiRNA

targeting human FAM35A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTGCTACATTCCAGGCATTGTACTAAGTATGGGGAACCACAGAGAAGACATTCCCTCAGAAACTGCTGCAGTGCTTTCGCTTATCCCTACCTAAAAAACCGTCAATGTGAAATCATTTCCTTGATTATAACTATAATGATAATGGATTAGTTTATATAAACCTATGTTTAGACAAGTTCAAGACAAGCGTGTCTTTCTATAAAAAGTATTGAAAATGAAGGAAATGAGATCATGTTTCAATTTATTAAAGCAGGGAAGAGCGTTCTGTGCTTAGTTCGTGTCTAGGATTTGAGTGCCTTACTGAATGCATTTACCAGCAAACATGTAGCAATCTGTTCTCTCATTGTGATTGTGGAAGAAGCTCATGTAAAATGATAGTCATTAATGAGGAAGTATGGCGTGG

Ensembl | Número de adesão de ser humano

ENSG00000165874

nº de adesão NCBI

NM_019054

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FAM35A(54537) , FAM35A(54537)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shengxian Gao et al.
Nature communications, 9(1), 3925-3925 (2018-09-27)
53BP1 with its downstream proteins, RIF1, PTIP and REV7, antagonizes BRCA1-dependent homologous recombination (HR) and promotes non-homologous end joining (NHEJ) in an unclear manner. Here we show that REV7 forms a complex with two proteins, FAM35A and C20ORF196. We demonstrate
Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica