Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU114221

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1AP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGACCAAACAGCTGCCAGTCCTAGGAAAATGCTGTGAAGAGATCCAGCCACATCAGTGGAAGCCACCTATAGAGAGAGAAGAACACCGGCTCCCATTCTGGTTAAAGGCCAGTCTGCCATCCATCCAGGAAGAACTGCGGCACATGGCTGATGGTGCTAGAGAGGTAGGAAATATGACTGGAACCACTGAGATCAACTCAGATCAAGGCCTAGAAAAAGACAACTCAGAGTTGGGGAGTGAAACTCGGTACCCACTGCTATTGCCTAAGGGTGTAGTCCTGAAACTGAAGCCAGTTGCCGACCGTTTCCCCAAGAAGGCTTGGAGACAGAAGCGTTCATCAGTCCTGAAACCCCTCCTTATCCAACCCAGCCCCTCTCTCCAGCCCAGCTTCAACCCTGGGAAAACAC

Ensembl | Número de adesão de ser humano

ENSG00000163374

nº de adesão NCBI

NM_032292

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... YY1AP1(55249) , YY1AP1(55249)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hyun-Jung Choi et al.
Nature communications, 6, 6943-6943 (2015-05-13)
Angiogenesis is regulated by the dynamic interaction between endothelial cells (ECs). Hippo-Yes-associated protein (YAP) signalling has emerged as a key pathway that controls organ size and tissue growth by mediating cell contact inhibition. However, the role of YAP in EC
David Fu et al.
Endocrine-related cancer, 21(2), 297-310 (2014-01-07)
The Hippo signaling pathway has been implicated as a conserved regulator of organ size in both Drosophila and mammals. Yes-associated protein (YAP), the central component of the Hippo signaling cascade, functions as an oncogene in several malignancies. Ovarian granulosa cell
C He et al.
Oncogene, 34(50), 6040-6054 (2015-03-24)
Mechanisms underlying ovarian cancer initiation and progression are unclear. Herein, we report that the Yes-associated protein (YAP), a major effector of the Hippo tumor suppressor pathway, interacts with ERBB signaling pathways to regulate the initiation and progression of ovarian cancer.
Upal Basu-Roy et al.
Nature communications, 6, 6411-6411 (2015-04-04)
The repressive Hippo pathway has a profound tumour suppressive role in cancer by restraining the growth-promoting function of the transcriptional coactivator, YAP. We previously showed that the stem cell transcription factor Sox2 maintains cancer stem cells (CSCs) in osteosarcomas. We
Ute Schütte et al.
Translational oncology, 7(2), 309-321 (2014-06-11)
Recent work has identified dysfunctional Hippo signaling to be involved in maintenance and progression of various human cancers, although data on clear cell renal cell carcinoma (ccRCC) have been limited. Here, we provide evidence implicating aberrant Hippo signaling in ccRCC

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica