Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU114181

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGATTTCACCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCATCTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGAGGTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAGTGGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACACATGGAGAAGTCTGCCCAGCGAACTGGACACCGGATTCTCCTA

Ensembl | Número de adesão de ser humano

ENSG00000165672

nº de adesão NCBI

NM_006793

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRDX3(10935) , PRDX3(10935)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Min-Yao Jiang et al.
Oncotarget, 8(46), 80295-80302 (2017-11-09)
Benign prostatic hyperplasia (BPH) is one of the most common diseases in the senior men and age plays an important role in the initiation and development of BPH. Mammalian cells primarily use the autophagy-lysosome system to degrade misfolded/aggregated proteins and
Inah Hwang et al.
Free radical biology & medicine, 131, 162-172 (2018-12-12)
Chronic kidney disease (CKD) has become epidemic worldwide. Mitochondrial reactive oxygen species (ROS)-induced oxidative stress is an important mediator of CKD, and Prx3 plays a critical role in maintenance of mitochondrial ROS. The present study examined the role of Prx3
Hua Zhang et al.
Oncotarget, 8(2), 3471-3480 (2016-12-15)
Peroxiredoxin (PRDX) proteins are involved in carcinogenesis. PRDX3, which is predominantly localized in mitochondria and up-regulated in several human cancers, seems to confer increased treatment resistance and aggressive phenotypes. This study examined the expression profile of PRDX3 and its possible
Brian Cunniff et al.
PloS one, 10(5), e0127310-e0127310 (2015-05-27)
Dysregulation of signaling pathways and energy metabolism in cancer cells enhances production of mitochondrial hydrogen peroxide that supports tumorigenesis through multiple mechanisms. To counteract the adverse effects of mitochondrial peroxide many solid tumor types up-regulate the mitochondrial thioredoxin reductase 2--thioredoxin

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica