Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU113871

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT18

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGA

Ensembl | Número de adesão de ser humano

ENSG00000111057

nº de adesão NCBI

NM_000224

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KRT18(3875) , KRT18(3875)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kenneth H Yu et al.
Journal of proteome research, 8(3), 1565-1576 (2009-02-10)
A novel approach to pancreatic cancer biomarker discovery has been developed, which employs a stable isotope labeled proteome (SILAP) standard coupled with extensive multidimensional separation coupled with tandem mass spectrometry (MS/MS). Secreted proteins from CAPAN-2 human pancreatic cancer derived cells
Zahra Khalaj et al.
Iranian journal of basic medical sciences, 19(1), 34-42 (2016-04-21)
The application of stem cells holds great promises in cell transplants. Considering the lack of optimal in vitro model for hepatogenic differentiation, this study was designed to examine the effects of laminin matrix on the improvement of in vitro differentiation
Christian Lehmann et al.
International journal of oncology, 41(6), 1932-1942 (2012-10-09)
The tumor-initiating capacity of primary human breast cancer cells is maintained in vitro by culturing these cells as spheres/aggregates. Inoculation of small cell numbers derived from these non-adherent cultures leads to rapid xenograft tumor formation in mice. Accordingly, injection of
Hyejung Jung et al.
Molecular and cellular biochemistry, 423(1-2), 21-28 (2016-11-04)
During epithelial-mesenchymal transition (EMT), epithelial cells lose key phenotypic markers (e.g., E-cadherin and cytokeratin 18) and acquire mesenchymal markers (e.g., N-cadherin and vimentin). Although the loss of cytokeratin 18 is a hallmark of EMT, the regulatory role of cytokeratin 18
Hyunee Yim et al.
Journal of Korean medical science, 21(4), 652-655 (2006-08-08)
Cytokeratin 18 (CK18) protein was identified as an airway epithelial cell autoantigen associated with nonallergic asthma. Cleavage of CK18 protein by caspase-3 is a marker of early apoptosis in epithelial cells. It has been shown that the expression of active
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica