Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU113451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB6A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAATCTCCCATGTCATCTTCAACCTTCTTCAGAAGCTCACTGCTTTGGCCCCCTTACTCTTTCATTGACTGCAGTGTGAATATTGGCTTGAACCTTTTCCCTTCAGTAATAACGTATTGCAATTCATCATTGCTGCCTGTCTC

Ensembl | Número de adesão de ser humano

ENSG00000175582

nº de adesão NCBI

NM_002869

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RAB6A(5870) , RAB6A(5870)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fang Wang et al.
Journal of cellular biochemistry (2018-11-13)
Previous studies have demonstrated that hypoxia can induce phenotypic modulation of pulmonary smooth muscle cells; however, the mechanisms remain unclear. The present study aimed to investigate the effect of the GTPase Rab6A-mediated phenotypic modulation and other activities of rat pulmonary
Anand Patwardhan et al.
Nature communications, 8, 15835-15835 (2017-06-14)
Exocytic carriers convey neo-synthesized components from the Golgi apparatus to the cell surface. While the release and anterograde movement of Golgi-derived vesicles require the small GTPase RAB6, its effector ELKS promotes the targeting and docking of secretory vesicles to particular
Haili Huang et al.
Cancer letters, 362(1), 15-24 (2015-03-11)
Our previous study demonstrated that microRNA 5100 (miR-5100) is overexpressed in lung cancer tissues; however, the function of miR-5100 remained elusive. In this study, we demonstrate that miR-5100 is highly expressed in a wide variety of lung cancer tissues and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica